ࡱ> PSO  ;bjbj77 .D]k]kz4N   8S$wt!(!!!!!!!{#1&d!E!U!@@@!@!@@z` Ԡ k!0!,& &  &" @!!!& : Genome resequencing Genome resequencing using the NEBNext Ultra II FS kit NEBNext libraries are very high quality but they are a lot of work and expensive. For more routine genome resequencing we use the Nextera XT kit (next page) Purify DNA using an appropriate method, quantify by QuBIT or PicoGreen Transfer 10-50 ng DNA into a 0.5 ml Lo bind tube, dilute to 13 l with 0.1x TE Add 3.5 l NEBNext Ultra II FS Reaction Buffer Vortex NEBNext Ultra II FS enzyme 5-8s immediately before adding 1 l to reaction Vortex 5s then run on following program in PCR machine with heated lid at 75 20 min @ 37C 30 min @ 65C Hold @ 4C Spin briefly then add 1.25 l 1:10 diluted NEBNext adaptor 0.5 l ligation enhancer 15 l NEBNext Ultra II ligation mix Pipette to mix and incubate 15 min at 20 Add 1.5 l USER enzyme and incubate 15 min at 37 Clean with 28 l AMPure beads, elute with 22 l 0.1x TE for 21 l yield In a PCR tube, mix 21 l library 2 l NEBNext index oligo 2 l NEBNext universal oligo 25 l NEBNext Ultra II Q5 PCR mix 98 30s 98 10s \ 65 75s / x 7 cycles (10ng) or 6 cycles (20-50ng) 65 5 min 4 hold Clean with 45 l AMPure beads, elute with 26 l 0.1xTE for yield Clean again with 22.5 l AMPure beads, elute with 11 l 0.1xTE for 10.5 l yield Genome resequencing using the Nextera XT kit Starting material is purified DNA, diluted to 200pg/l. Quantify DNA accurately using PicoGreen dsDNA or Qubit dsDNA as this kit is very sensitive to input amount. In a PCR tube mix: 2 l TD 1 l 200 pg/l DNA [the correct amount of DNA is critical!] incubate 2 min on ice While still on ice, add 1 l ATM mix by pipetting In a PCR machine, run the following program, transfer the samples from ice to the block exactly as soon as the block reaches 55 55 for 5 min then 4 hold Add 1 l NT, mix Incubate at room temperature for 5 min Sat on ice for a while Add 1 l each oligo (one each of N and S oligos) (at 5uM) [see index choice] 3 l NPM mix Run the following PCR pgrogram: 72 3 min 95 30s 95 10s \ 55 30s | x12 72 30s / 72 5 min 10 hold Added 10 l water Clean with 12 l AMPure beads Elute in 10.5 l 0.1x TE for 10 l yield It is normal just to bioanalyse 1-2 libraries per batch of 8 as they are pretty consistent Index choice Use the following N indexes to be compatible with other index sets (NEBNext based): N716, N718, N719, N720, N721, N726, N727, N705 Use S different primers (each of which is also indexed) to get multiple libraries into a single N index We also have custom Nextera N primers with NEBNext indexes if you prefer NexteraNEBNext N1CAAGCAGAAGACGGCATACGAGAT CGTGAT GTCTCGTGGGCTCGGNexteraNEBNext N2CAAGCAGAAGACGGCATACGAGAT ACATCG GTCTCGTGGGCTCGGNexteraNEBNext N3CAAGCAGAAGACGGCATACGAGAT GCCTAA GTCTCGTGGGCTCGGNexteraNEBNext N4CAAGCAGAAGACGGCATACGAGAT TGGTCA GTCTCGTGGGCTCGGNexteraNEBNext N5CAAGCAGAAGACGGCATACGAGAT CACTGT GTCTCGTGGGCTCGGNexteraNEBNext N6CAAGCAGAAGACGGCATACGAGAT ATTGGC GTCTCGTGGGCTCGGNexteraNEBNext N7CAAGCAGAAGACGGCATACGAGAT GATCTG GTCTCGTGGGCTCGGNexteraNEBNext N8CAAGCAGAAGACGGCATACGAGAT TCAAGT GTCTCGTGGGCTCGGNexteraNEBNext N9CAAGCAGAAGACGGCATACGAGAT CTGATC GTCTCGTGGGCTCGGNexteraNEBNext N10CAAGCAGAAGACGGCATACGAGAT AAGCTA GTCTCGTGGGCTCGGNexteraNEBNext N11CAAGCAGAAGACGGCATACGAGAT GTAGCC GTCTCGTGGGCTCGGNexteraNEBNext N12CAAGCAGAAGACGGCATACGAGAT TACAAG GTCTCGTGGGCTCGGNexteraNEBNext N13CAAGCAGAAGACGGCATACGAGAT TTGACT GTCTCGTGGGCTCGGNexteraNEBNext N14CAAGCAGAAGACGGCATACGAGAT GGAACT GTCTCGTGGGCTCGG3FKL1 2 = > @ q r   & t  H J    , . @ B p &h%1hxz&d89OQr"$57^`wy} *4=?QSTqst h[Z5\ h =hOhOh[Z h =hNhNhN5\hNh)hehoh%1N9OQr"$57^`wy} [$\$gdN[$\$`gdN *4=?QSqs\]@AS$IfgdNgdP,t [$\$gdN[$\$`gdN\]?@AS  LM_(XYk#$7gh{88C8D8W88888888899?99˽hNhP,th(35\hP,thN5\Uh,/+CJaJ#h,/+B*CJOJQJ^JaJphhP,t h[Zh[Zh[ZJ KVkd~$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+  LM_KVkdz$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+KVkdv$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+(XYkKVkdr$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+#KVkdn$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+#$7gh{KVkdj$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+8C8KVkdf$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+NexteraNEBNext N15CAAGCAGAAGACGGCATACGAGAT TGACAT GTCTCGTGGGCTCGGNexteraNEBNext N16CAAGCAGAAGACGGCATACGAGAT GGACGG GTCTCGTGGGCTCGG Additional protocol (provided by Reik lab): NPM is the limiting reagent but the PCR can be performed with other reagents as follows: Alternative PCR mastermix (when NPM runs out) This is for a 3.75ul final tagmentation volume (previous protocol gives 5ul), so will need to be scaled add 5.5ul of KAPA hifi readymix and 0.25ul of Bst2.0 Add 1.5ul primer mix volume is now 11ul vortex and spin cycle: 65c 5min 98c 45s 12 cycles of: 98c 15s 60c 15s <---- 65 works but with slightly lower yield 72c 30s 72c 1min  Ensure all white precipitate is fully dissolved      FILENAME genome resequencing v1.2 Houseley lab  PAGE 1 C8D8W8888888KFFFFgdNVkdb$$Ifl 0 $g g t$644 lBalyt,/+$IfVkd$$Ifl 0 $g g t$644 lBalyt,/+899?9999:::$:,:::B:y::::::::::: & Fgd[% & FgdN & FgdN & FgdNgdNgdN999:::$:,:::B:y:::::::::::::::::::::::::::::::;;;; ; ; ; ; ;˾˺˰h0JmHnHu h(0Jjh(0JUh%hhNmHnHuh(jh(Uh=}jh=}Uh7hojho0JU hP,thP,thN1::::: ; ; ; ; & Fgd[%,1h. A!"#$% |$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+|$$Ifl!vh#v #v:V l  t$6,5 59/ Balyt,/+x02 0@P`p2( 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p8XV~ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@66666_HmH nH sH tH @`@ NormalCJ_HaJmH sH tH f@f N Heading 2$$d@&#5B*CJOJQJ\aJphOtH DA`D Default Paragraph FontRi@R  Table Normal4 l4a (k (No List 4@4 Mr2Header  9r 4 @4 Mr2Footer  9r .)@. Mr2 Page Number>@"> o Footnote TextCJaJ<1< oFootnote Text Char@&`A@ oFootnote ReferenceH*X/QX NHeading 2 Char#5B*CJOJQJ\aJphOtH B^@bB N0 Normal (Web)dd[$\$f@rf N List Paragraphd^m$CJOJPJQJaJtH PK![Content_Types].xmlN0EH-J@%ǎǢ|ș$زULTB l,3;rØJB+$G]7O٭Vzt7.??Źڨd/L+[梃 _¯UjyA_/֖j-A %4\/%ި+K|h(Kmgk):b| H$Y 9DZ.6)A2&`RV!*_[`dI+^DL-)>qfoΟ~_'ҨrQrW_ƿw!pƦ7/_zqԵbp@m ?ItDl,(CjLQc׎O9!N@Iw{Xe3b|`:2˭A9Tn$ءy@Q&Q3,;sg8v%= CN4I ~> zHzw0u $J}*;(wL|$C޳q-!1,hEX>ZN yݾKt l&;HPm%6sq !&}] ~@Lw?%q d98@7C̜mia_Y㩓b8F vB{cNQqsu;6~@VƾzXU+f:OllD,E|=mVePاcGxe_+gj=HSԳ;{yи½|mHmA`0D_cU\+w/ 9MOJK:WnǯIUsffn`<"K*2:&w4]3۸cB/br;}̸uF̘G}ҙ3>-=k&ڂE%睸 |Te6pp1GZ&L~AdNPjĢP gFFz٫[ euRTVxC'c*ibQTz:"dC%1!4ZŲR?rՔ)Zf\5GμMO20V4'|:xt&Ԯiv +nD?TWq]_7.u)S 4?⦾@3;S,8;^K=7>̌cC ^$77&%Bn"cy@I K?L'CWc%WSc#^w}ܓ߭ei)$ Z`%v]:Blqwae&De*2JǐYG4OPQRlnຠtSi832IQ QrZ.afٽ\HYʚU6iaT&ly*o]M̹Qh2/woQoPSJŪ[lDY&`Riڊ0z۶ܫ/PK! ѐ'theme/theme/_rels/themeManager.xml.relsM 0wooӺ&݈Э5 6?$Q ,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{P8g/]QAsم(#L[PK-![Content_Types].xmlPK-!֧6 0_rels/.relsPK-!kytheme/theme/themeManager.xmlPK-!wG theme/theme/theme1.xmlPK-! ѐ'Q theme/theme/_rels/themeManager.xml.relsPK]L 36D @@MMMP&9 ;  J  #C88: ;! +AHJP!8@0(  B S  ?#Zc-4  A O  M [  $ Y g $ 2 h v 4BJVz2dmz333=@Gc   ? yyyz|=@Gc   ? yyyz|TWg*  ^`hH. ^`hH. pL^p`LhH. @ ^@ `hH. ^`hH. L^`LhH. ^`hH. ^`hH. PL^P`LhH.TWg LTe.lL           s;0/DMmp.%*,/+%1Mr2(3; BcH7TYs,[QycRdg%+mxom@ABCDEFHIJKLMNQRURoot Entry Fn%ԠT@Data #1Table+&WordDocument .DSummaryInformation(?DocumentSummaryInformation8GMsoDataStoreԠԠ0R2HB5GEE0LYAA==2ԠԠItem  2PropertiesUCompObj r   F Microsoft Word 97-2003 Document MSWordDocWord.Document.89q